Review



human fetal kidney marathon ready cdna  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    TaKaRa human fetal kidney marathon ready cdna
    Human Fetal Kidney Marathon Ready Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 140 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+fetal+kidney+marathon+ready+cdna/Human+Kidney+Marathon+-Ready+cDNA/pmc04117780-32-5-10
    Average 94 stars, based on 140 article reviews
    human fetal kidney marathon ready cdna - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    other:

    Article Title: Long non-coding RNA INXS is a critical mediator of BCL-XS induced apoptosis
    Article Snippet: For RACE-PCR we used the Human Fetal Kidney Marathon-Ready cDNA (Clontech, No. 639323) commercial library prepared from poly(A) RNA extracted from a pool of 59 spontaneously aborted fetal kidneys.

    Sequencing:

    Article Title: Mitogenic oxygenase regulators
    Article Snippet: .. 5′- and 3′-RACE were carried out using human fetal kidney marathon-ready cDNA (Clontech, Palo Alto, Calif.), using the following four primers which were designed based on the genomic sequence: SEQ ID NO:15, 5′-CTCATTGTCACACTCCTCGACAGC-3′; SEQ ID NO:16, 5′-TGGGTCTGATGCCTTGAAGGACTC-3′(for nested PCR); 3′-RACE: SEQ ID NO:17, 5′-ATCAAGCGGCCCCCTTTTTTTCAC-3′; SEQ ID NO:18, 5′-CTGAACATCCCCACCATTGCTCGC-3′(for nested PCR). .. PCR parameters were 95° C. for 30 s, 62° C. or 65° C. for 20 s, 72° C. for 45 s, 25-35 cycles as indicated after denaturing for 1.5 minutes at 95° C. PCR products were purified with a QIAquick PCR purification kit or a gel purification kit (QIAGEN, Valencia, Calif.).

    Article Title: Mitogenic oxygenase regulators
    Article Snippet: .. 5′- and 3′-RACE were carried out using human fetal kidney marathon-ready cDNA (Clontech, Palo Alto, Calif.), using the following four primers which were designed based on the genomic sequence: SEQ ID NO:15, 5′-CTCATTGTCACACTCCTCGACAGC-3′; SEQ ID NO:16, 5′-TGGGTCTGATGCCTTGAAGGACTC-3′ (for nested PCR); 3′-RACE: SEQ ID NO:17, 5′-ATCAAGCGGCCCCCTTTTTTTCAC-3′; SEQ ID NO:18, 5′-CTGAACATCCCCACCATTGCTCGC-3′ (for nested PCR). .. PCR parameters were 95° C. for 30s, 62° C. or 65° C. for 20s, 72° C. for 45s, 25-35 cycles as indicated after denaturing for 1.5 minutes at 95° C. PCR products were purified with a QIAquick PCR purification kit or a gel purification kit (QIAGEN, Valencia, Calif.).

    Nested PCR:

    Article Title: Mitogenic oxygenase regulators
    Article Snippet: .. 5′- and 3′-RACE were carried out using human fetal kidney marathon-ready cDNA (Clontech, Palo Alto, Calif.), using the following four primers which were designed based on the genomic sequence: SEQ ID NO:15, 5′-CTCATTGTCACACTCCTCGACAGC-3′; SEQ ID NO:16, 5′-TGGGTCTGATGCCTTGAAGGACTC-3′(for nested PCR); 3′-RACE: SEQ ID NO:17, 5′-ATCAAGCGGCCCCCTTTTTTTCAC-3′; SEQ ID NO:18, 5′-CTGAACATCCCCACCATTGCTCGC-3′(for nested PCR). .. PCR parameters were 95° C. for 30 s, 62° C. or 65° C. for 20 s, 72° C. for 45 s, 25-35 cycles as indicated after denaturing for 1.5 minutes at 95° C. PCR products were purified with a QIAquick PCR purification kit or a gel purification kit (QIAGEN, Valencia, Calif.).

    Article Title: Mitogenic oxygenase regulators
    Article Snippet: .. 5′- and 3′-RACE were carried out using human fetal kidney marathon-ready cDNA (Clontech, Palo Alto, Calif.), using the following four primers which were designed based on the genomic sequence: SEQ ID NO:15, 5′-CTCATTGTCACACTCCTCGACAGC-3′; SEQ ID NO:16, 5′-TGGGTCTGATGCCTTGAAGGACTC-3′ (for nested PCR); 3′-RACE: SEQ ID NO:17, 5′-ATCAAGCGGCCCCCTTTTTTTCAC-3′; SEQ ID NO:18, 5′-CTGAACATCCCCACCATTGCTCGC-3′ (for nested PCR). .. PCR parameters were 95° C. for 30s, 62° C. or 65° C. for 20s, 72° C. for 45s, 25-35 cycles as indicated after denaturing for 1.5 minutes at 95° C. PCR products were purified with a QIAquick PCR purification kit or a gel purification kit (QIAGEN, Valencia, Calif.).

    Polymerase Chain Reaction:

    Article Title: Mitogenic oxygenase regulators
    Article Snippet: .. PCR was carried out using human fetal kidney marathon-ready cDNA (Clontech, Palo Alto, Calif.), and the 0.85 kb product was sequenced. ..

    Article Title: Role of Human Sphingosine-1-phosphate Phosphatase 1 in the Regulation of Intra- and Extracellular Sphingosine-1-phosphate Levels and Cell Viability
    Article Snippet: .. Using PCR-based cloning strategies, we used primers P5 (5 -GCTCCATTCATCATCATCGG-3 ) and P6 (5 -ATAGAATTCTCAAGAGATACCAATAAAGAAAAATATGT) to clone a 456-bp fragment from the 3 -region of the proposed open reading frame (ORF) for human SPPase using human fetal kidney Marathon-ready cDNA (Clontech). ..

    Article Title: Mitogenic oxygenase regulators
    Article Snippet: .. PCR was carried out using human fetal kidney marathon-ready cDNA (Clontech, Palo Alto, Calif.), and the 0.85 kb product was sequenced. ..

    Cloning:

    Article Title: Role of Human Sphingosine-1-phosphate Phosphatase 1 in the Regulation of Intra- and Extracellular Sphingosine-1-phosphate Levels and Cell Viability
    Article Snippet: .. Using PCR-based cloning strategies, we used primers P5 (5 -GCTCCATTCATCATCATCGG-3 ) and P6 (5 -ATAGAATTCTCAAGAGATACCAATAAAGAAAAATATGT) to clone a 456-bp fragment from the 3 -region of the proposed open reading frame (ORF) for human SPPase using human fetal kidney Marathon-ready cDNA (Clontech). ..



    Similar Products

    human fetal kidney marathon ready cdna  (TaKaRa)
    94
    TaKaRa human fetal kidney marathon ready cdna
    Human Fetal Kidney Marathon Ready Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+fetal+kidney+marathon+ready+cdna/Human+Kidney+Marathon+-Ready+cDNA/pmc04117780-32-5-10
    Average 94 stars, based on 1 article reviews
    human fetal kidney marathon ready cdna - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    human fetal kidney marathon ready cdna library  (TaKaRa)
    94
    TaKaRa human fetal kidney marathon ready cdna library
    Conservation analysis of intronic antisense lncRNAs expressed in RCC. (A) TransMap cross-species <t>cDNA</t> alignments in 15 vertebrate species (rows; species common name and library version in brackets) of 2594 intronic antisense lncRNAs expressed in renal tissue and with conserved expression in at least one species (green dashes show expression conservation). (B) Bar graph of the TransMap analysis showing a higher proportion of expression conservation of the lncRNA dataset compared with a random sequence dataset (Fisher test p <0.0001). (C) DNA sequence conservation of antisense lncRNAs within vertebrates, placental and primates groups. Black bars show the number of lncRNAs, and gray bars the number of random genomic regions, overlapping PhastCons elements (see Material and methods for details). Asterisks show statistically significant differences in the number of overlapping elements (Fisher test p <0.0001). (D) Venn Diagram of three different conservation analyses of the intronic lncRNAs expressed in RCC: RNAz predicted secondary structure conservation for 131 lncRNAs, PhastCons DNA sequence conservation for 3241 lncRNAs and TransMap expression conservation for 2594 lncRNAs.
    Human Fetal Kidney Marathon Ready Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+fetal+kidney+marathon+ready+cdna/Human+Kidney+Marathon+-Ready+cDNA/pmc03834536-332-1-7
    Average 94 stars, based on 1 article reviews
    human fetal kidney marathon ready cdna library - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    fetal kidney marathon ready cdna  (TaKaRa)
    94
    TaKaRa fetal kidney marathon ready cdna
    RPTPs form a complex with polycystin-1. Polycystin-1 was immunoprecipitated from cell lysates using a specific antibody, PWPC-1, directed against the CPC-1. (A) Immunoblot analyses of whole cell lysates from immortalized normal human kidney (NHCT) and ADPKD cells, control IgG immunoprecipitates and polycystin-1 immunoprecipitates were performed to detect the presence of polycystin-1, RPTPσ, RPTPγ and LAR. Enrichment shown in graph was calculated as fraction of protein immunoprecipitated with PC1 antibody relative to the fraction of protein precipitated with control IgG. (B) Immunoblot analyses of whole cell lysates from immortalized normal human <t>fetal</t> <t>kidney</t> (NFCT) cells for polycystin-1 and RPTPδ Fold enrichment of RPTPδ in PC1 immunoprecipitates was 5-fold (calculated as described in panel A). Asterisk denotes IgG heavy chain in the immunoprecipitates. Proteins were detected with the following antibodies: polycystin-1 (PWPC-1), RPTPσ (17G7.2), LAR (BD Biosciences), RPTPγ (CBPTPγ), RPTPδ (KTPTPδ), control panel A (isotype matched Ig), control panel B (irrelevant antibody against sprouty). N=4 for all panels.
    Fetal Kidney Marathon Ready Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+fetal+kidney+marathon+ready+cdna/Human+Kidney+Marathon+-Ready+cDNA/pmc03156852-102-9-13
    Average 94 stars, based on 1 article reviews
    fetal kidney marathon ready cdna - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    old human fetal kidney  (TaKaRa)
    94
    TaKaRa old human fetal kidney
    RPTPs form a complex with polycystin-1. Polycystin-1 was immunoprecipitated from cell lysates using a specific antibody, PWPC-1, directed against the CPC-1. (A) Immunoblot analyses of whole cell lysates from immortalized normal human kidney (NHCT) and ADPKD cells, control IgG immunoprecipitates and polycystin-1 immunoprecipitates were performed to detect the presence of polycystin-1, RPTPσ, RPTPγ and LAR. Enrichment shown in graph was calculated as fraction of protein immunoprecipitated with PC1 antibody relative to the fraction of protein precipitated with control IgG. (B) Immunoblot analyses of whole cell lysates from immortalized normal human <t>fetal</t> <t>kidney</t> (NFCT) cells for polycystin-1 and RPTPδ Fold enrichment of RPTPδ in PC1 immunoprecipitates was 5-fold (calculated as described in panel A). Asterisk denotes IgG heavy chain in the immunoprecipitates. Proteins were detected with the following antibodies: polycystin-1 (PWPC-1), RPTPσ (17G7.2), LAR (BD Biosciences), RPTPγ (CBPTPγ), RPTPδ (KTPTPδ), control panel A (isotype matched Ig), control panel B (irrelevant antibody against sprouty). N=4 for all panels.
    Old Human Fetal Kidney, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+fetal+kidney+marathon+ready+cdna/Human+Kidney+Marathon+-Ready+cDNA/us07842788-324-30-34
    Average 94 stars, based on 1 article reviews
    old human fetal kidney - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    fetal kidney marathon ready cdna library  (TaKaRa)
    94
    TaKaRa fetal kidney marathon ready cdna library
    RPTPs form a complex with polycystin-1. Polycystin-1 was immunoprecipitated from cell lysates using a specific antibody, PWPC-1, directed against the CPC-1. (A) Immunoblot analyses of whole cell lysates from immortalized normal human kidney (NHCT) and ADPKD cells, control IgG immunoprecipitates and polycystin-1 immunoprecipitates were performed to detect the presence of polycystin-1, RPTPσ, RPTPγ and LAR. Enrichment shown in graph was calculated as fraction of protein immunoprecipitated with PC1 antibody relative to the fraction of protein precipitated with control IgG. (B) Immunoblot analyses of whole cell lysates from immortalized normal human <t>fetal</t> <t>kidney</t> (NFCT) cells for polycystin-1 and RPTPδ Fold enrichment of RPTPδ in PC1 immunoprecipitates was 5-fold (calculated as described in panel A). Asterisk denotes IgG heavy chain in the immunoprecipitates. Proteins were detected with the following antibodies: polycystin-1 (PWPC-1), RPTPσ (17G7.2), LAR (BD Biosciences), RPTPγ (CBPTPγ), RPTPδ (KTPTPδ), control panel A (isotype matched Ig), control panel B (irrelevant antibody against sprouty). N=4 for all panels.
    Fetal Kidney Marathon Ready Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+fetal+kidney+marathon+ready+cdna/Human+Kidney+Marathon+-Ready+cDNA/pm19681038-64-11-17
    Average 94 stars, based on 1 article reviews
    fetal kidney marathon ready cdna library - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Conservation analysis of intronic antisense lncRNAs expressed in RCC. (A) TransMap cross-species cDNA alignments in 15 vertebrate species (rows; species common name and library version in brackets) of 2594 intronic antisense lncRNAs expressed in renal tissue and with conserved expression in at least one species (green dashes show expression conservation). (B) Bar graph of the TransMap analysis showing a higher proportion of expression conservation of the lncRNA dataset compared with a random sequence dataset (Fisher test p <0.0001). (C) DNA sequence conservation of antisense lncRNAs within vertebrates, placental and primates groups. Black bars show the number of lncRNAs, and gray bars the number of random genomic regions, overlapping PhastCons elements (see Material and methods for details). Asterisks show statistically significant differences in the number of overlapping elements (Fisher test p <0.0001). (D) Venn Diagram of three different conservation analyses of the intronic lncRNAs expressed in RCC: RNAz predicted secondary structure conservation for 131 lncRNAs, PhastCons DNA sequence conservation for 3241 lncRNAs and TransMap expression conservation for 2594 lncRNAs.

    Journal: Molecular Cancer

    Article Title: Expression analysis and in silico characterization of intronic long noncoding RNAs in renal cell carcinoma: emerging functional associations

    doi: 10.1186/1476-4598-12-140

    Figure Lengend Snippet: Conservation analysis of intronic antisense lncRNAs expressed in RCC. (A) TransMap cross-species cDNA alignments in 15 vertebrate species (rows; species common name and library version in brackets) of 2594 intronic antisense lncRNAs expressed in renal tissue and with conserved expression in at least one species (green dashes show expression conservation). (B) Bar graph of the TransMap analysis showing a higher proportion of expression conservation of the lncRNA dataset compared with a random sequence dataset (Fisher test p <0.0001). (C) DNA sequence conservation of antisense lncRNAs within vertebrates, placental and primates groups. Black bars show the number of lncRNAs, and gray bars the number of random genomic regions, overlapping PhastCons elements (see Material and methods for details). Asterisks show statistically significant differences in the number of overlapping elements (Fisher test p <0.0001). (D) Venn Diagram of three different conservation analyses of the intronic lncRNAs expressed in RCC: RNAz predicted secondary structure conservation for 131 lncRNAs, PhastCons DNA sequence conservation for 3241 lncRNAs and TransMap expression conservation for 2594 lncRNAs.

    Article Snippet: The Human Fetal Kidney Marathon-Ready cDNA library (Clontech) and the Marathon cDNA Amplification Kit (Clontech) were used to perform the 3′- and 5′ RACE-PCR, following the manufacturer instructions with the following primers: HDAC5_F_GSP_RACE: AGGAGCCCTGCAGAGAGCACATGG; HDAC5-F_Nested_RACE: AAGGGGAATCTCCCACCAGCCTGTC; HDAC5-R_GSP_RACE: GGGGTGCTGCATGTCACCCAGTC; HDAC5-R_Nested_RACE: TGGAGTCGCCTGTGCTTCCTGTTTG.

    Techniques: Expressing, Sequencing

    RPTPs form a complex with polycystin-1. Polycystin-1 was immunoprecipitated from cell lysates using a specific antibody, PWPC-1, directed against the CPC-1. (A) Immunoblot analyses of whole cell lysates from immortalized normal human kidney (NHCT) and ADPKD cells, control IgG immunoprecipitates and polycystin-1 immunoprecipitates were performed to detect the presence of polycystin-1, RPTPσ, RPTPγ and LAR. Enrichment shown in graph was calculated as fraction of protein immunoprecipitated with PC1 antibody relative to the fraction of protein precipitated with control IgG. (B) Immunoblot analyses of whole cell lysates from immortalized normal human fetal kidney (NFCT) cells for polycystin-1 and RPTPδ Fold enrichment of RPTPδ in PC1 immunoprecipitates was 5-fold (calculated as described in panel A). Asterisk denotes IgG heavy chain in the immunoprecipitates. Proteins were detected with the following antibodies: polycystin-1 (PWPC-1), RPTPσ (17G7.2), LAR (BD Biosciences), RPTPγ (CBPTPγ), RPTPδ (KTPTPδ), control panel A (isotype matched Ig), control panel B (irrelevant antibody against sprouty). N=4 for all panels.

    Journal:

    Article Title: Receptor protein tyrosine phosphatases are novel components of a polycystin complex

    doi: 10.1016/j.bbadis.2010.11.006

    Figure Lengend Snippet: RPTPs form a complex with polycystin-1. Polycystin-1 was immunoprecipitated from cell lysates using a specific antibody, PWPC-1, directed against the CPC-1. (A) Immunoblot analyses of whole cell lysates from immortalized normal human kidney (NHCT) and ADPKD cells, control IgG immunoprecipitates and polycystin-1 immunoprecipitates were performed to detect the presence of polycystin-1, RPTPσ, RPTPγ and LAR. Enrichment shown in graph was calculated as fraction of protein immunoprecipitated with PC1 antibody relative to the fraction of protein precipitated with control IgG. (B) Immunoblot analyses of whole cell lysates from immortalized normal human fetal kidney (NFCT) cells for polycystin-1 and RPTPδ Fold enrichment of RPTPδ in PC1 immunoprecipitates was 5-fold (calculated as described in panel A). Asterisk denotes IgG heavy chain in the immunoprecipitates. Proteins were detected with the following antibodies: polycystin-1 (PWPC-1), RPTPσ (17G7.2), LAR (BD Biosciences), RPTPγ (CBPTPγ), RPTPδ (KTPTPδ), control panel A (isotype matched Ig), control panel B (irrelevant antibody against sprouty). N=4 for all panels.

    Article Snippet: Specific RPTP domains were amplified by PCR from human fetal kidney marathon-ready cDNA (Clontech) and verified by direct sequencing.

    Techniques: Immunoprecipitation, Western Blot, Control

    RPTPσ and RPTPδ localisation in renal epithelial cells. (A) Stably transfected IMCD cells expressed RPTPσ::GFP construct (green) at the basolateral plasma membrane. Nuclei labeled with DAPI (blue). The expressed RPTPσ isoform is a major isolated from a kidney cDNA library, lacking FNIII domains 4–7. (B) Confocal immunofluorescence images of RPTPσ (17G7.2 mAb) and polycystin-1 (PKD domain 1, Dom1 pAb) at the basolateral membrane in IMCD cells. (C) Confocal immunofluorescence image of RPTPσ (17G7.2) and pan-cadherin at the lateral membrane in A431 cells. (D–E) Confocal immunofluorescence images of confluent RCTEC and PKD9–12 cells labelled with antibodies directed against RPTPσ (KTRPTPσ) and E-cadherin (Transduction Laboratories). (F–G) Confocal immunofluorescence images of confluent RCTEC and PKD9–12 cells labelled for RPTPδ (KTPTPδ) and E-cadherin. Panels D and F: cells were grown on glass coverslips. Panels E and G: cells were grown on 0.4 µm filter supports. (H) Confocal immunofluorescence images of confluent normal (67F05) and ADPKD (51M06) primary kidney cells labelled with antibodies directed against RPTPσ (KTRPTPσ) and E-cadherin (Transduction Laboratories). (I) Confocal immunofluorescence images of subconfluent, spreading normal (57M03) and ADPKD (46F04) primary kidney cells labelled with antibodies directed against RPTPδ (KTPTPδ) and E-cadherin (Transduction Laboratories). N≥3 for all panels.

    Journal:

    Article Title: Receptor protein tyrosine phosphatases are novel components of a polycystin complex

    doi: 10.1016/j.bbadis.2010.11.006

    Figure Lengend Snippet: RPTPσ and RPTPδ localisation in renal epithelial cells. (A) Stably transfected IMCD cells expressed RPTPσ::GFP construct (green) at the basolateral plasma membrane. Nuclei labeled with DAPI (blue). The expressed RPTPσ isoform is a major isolated from a kidney cDNA library, lacking FNIII domains 4–7. (B) Confocal immunofluorescence images of RPTPσ (17G7.2 mAb) and polycystin-1 (PKD domain 1, Dom1 pAb) at the basolateral membrane in IMCD cells. (C) Confocal immunofluorescence image of RPTPσ (17G7.2) and pan-cadherin at the lateral membrane in A431 cells. (D–E) Confocal immunofluorescence images of confluent RCTEC and PKD9–12 cells labelled with antibodies directed against RPTPσ (KTRPTPσ) and E-cadherin (Transduction Laboratories). (F–G) Confocal immunofluorescence images of confluent RCTEC and PKD9–12 cells labelled for RPTPδ (KTPTPδ) and E-cadherin. Panels D and F: cells were grown on glass coverslips. Panels E and G: cells were grown on 0.4 µm filter supports. (H) Confocal immunofluorescence images of confluent normal (67F05) and ADPKD (51M06) primary kidney cells labelled with antibodies directed against RPTPσ (KTRPTPσ) and E-cadherin (Transduction Laboratories). (I) Confocal immunofluorescence images of subconfluent, spreading normal (57M03) and ADPKD (46F04) primary kidney cells labelled with antibodies directed against RPTPδ (KTPTPδ) and E-cadherin (Transduction Laboratories). N≥3 for all panels.

    Article Snippet: Specific RPTP domains were amplified by PCR from human fetal kidney marathon-ready cDNA (Clontech) and verified by direct sequencing.

    Techniques: Stable Transfection, Transfection, Construct, Clinical Proteomics, Membrane, Labeling, Isolation, cDNA Library Assay, Immunofluorescence, Transduction